2022 Programme
  • About Us
    • Our Team
    • Mission & Values
    • Frequently Asked Questions
    • Privacy Policy
  • Events
    • Pre-Festival Events
    • Street Festival
    • Performance Festival
    • Satellite Events
    • Virtual Festival
    • Virtual Escape Room
    • Explore the Arches
  • Get Involved
    • Internships
    • Job Opportunities
    • Sponsorships
    • Volunteers
    • Organisations, Artists & Researchers
  • Partners
  • Getting There
  • Contact
Science in the City 2022 Science in the City 2022
  • About Us
    • Our Team
    • Mission & Values
    • Frequently Asked Questions
    • Privacy Policy
  • Events
    • Pre-Festival Events
    • Street Festival
    • Performance Festival
    • Satellite Events
    • Virtual Festival
    • Virtual Escape Room
    • Explore the Arches
  • Get Involved
    • Internships
    • Job Opportunities
    • Sponsorships
    • Volunteers
    • Organisations, Artists & Researchers
  • Partners
  • Getting There
  • Contact
2022 Programme
Science in the City 2022

Explore the Arches - How the health!

The National Alliance for Rare Diseases Support - Malta

Festival Area: How the health!

Organisation Description:

The National Alliance for Rare Diseases Support – Malta is a voluntary, nonprofit organization, which brings together all stakeholders including patients and their relatives, researchers, medical professionals and other organizations representing specific rare diseases and conditions, thus providing a stronger voice than a single rare disease support group.

Website
Facebook

The Role of DNA testing in Rare Disease Research and Diagnostics

  1. Obtaining a DNA sample:

To show a simple blood vial (empty) that shows where we collect patient blood and show a swab/container where a sample taken from the mouth can be collected. Explanation – the principle that cells either from blood, or from the mouth, will contain nucleus that in turn contains the persons’ DNA.

  1. Amplifying DNA using a specialised tool called PCR:

To will explain that the DNA sample obtained in step 1, will be subjected to a tool/ technique in the lab called PCR – that stands for Polymerase Chain Reaction. Its role is to amplify million-fold the signal, amplify million-fold the DNA sequence of interest where we suspect there is a mutation, a variant in the DNA – that is usually responsible for causing a Rare Disease. We have 3 billion DNA ‘letters’ in one cell. And all it takes is ONE, only ONE of these 3 billion to be miscorrect, or erroneously placed – and it causes a disease.

  1. Reading DNA by Sequencing:

Finally, describing the tool called DNA Sequencing, which is a tool that ‘reads’ the amplified DNA obtained in step 2. It will provide a scientist with the EXACT DNA sequence (i.e., ATTCAGTACGATACGATACGACATCTA etc) and hence one can know exactly whether the DNA sequence is normal, or Not. If not, what is the mutation, and is it responsible for causing the disease? 

Conclusion – a brief description of how to interpret these DNA sequences.

logo (2)

Contact Us

[email protected]

Join the Mailing List

Stay up to date!

Privacy Policy

Science in the City is part of the EU-wide celebration, European Researchers’ Night. It is co-funded by the European Union’s Horizon Europe Research and Innovation Programme, under grant agreement No 101061120, the Arts Council Malta (ACM), Esplora STEM Engagement fund and a number of corporate sponsors. It is recognised by Europe for Festivals and Festivals for Europe (EFFE). 

The Science in the City consortium is led by the University of Malta and the Malta Chamber of Scientists, in partnership with the Ministry for Education, Sport, Youth, Research and Innovation, Trust Stamp Ltd, MCAST, Qualia Analytics, Esplora, tech.mt, BPC International, SEM, PBS, Spazju Kreattiv, Aquabiotech, Valletta Design Cluster, Valletta Cultural Agency, Transport Malta, The Environment Resource Agency, WasteServ, Heritage Malta and More or Less Theatre. 

This communication reflects the author’s view and the European Commission is not responsible for any information it contains. 

Copy